| Description | These cells will be suitable for studying the function of Sirt7 and Sirtuin protein family |
| Tissue/Organ/Organ System | Lung |
| Size | 1*106 cells/1.0 ml |
| Species | Human |
| Format | Frozen |
| Shipping Info | Dry Ice |
| Quality Control | 1) Immunofluorescence; 2) DNA analysis and qPCR; 3) AgNOR staining |
| Storage Conditions | Liquid Nitrogen |
| Growth Properties | Adherent |
| Categories | Drug Discovery Cell Lines |
| Seeding Density | 10,000 - 20,000 cells/cm2 |
| Applications | For Research Use Only |
| Cell Morphology | Epithelial-like |
| Donor Age | 43 years old |
| Donor Gender | Male |
| Expression Profile | Puromycin resistance at the concentration of 5 ug/mL. The cells stably express the short hairpin RNA (shRNA) scramble sequence: 5'-CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTT AGG-3' and the Sirt7 specific shRNA 5'- CCGGGTCCAGCCTGAAGGTTCTAAACTCGAGTTTAGAACCTTCAGGCTGGACTTTTTG-3'. |
| Population Doubling Time | 43 - 53 hours |
| Preservation Protocol | 1. Freeze Medium: Complete growth medium with 20% FBS and 10% DMSO. 2. Storage Temperature: Liquid Nitrogen vapour phase. |
| Price | Inquiry |
- HOME
- About Us
- Cell Lines
- Custom Knockout Cell Lines
- Drug Discovery Cell Lines
- Immortalized Cells
- Adipose
- Airway/Lung
- Auditory
- Bladder
- Blood
- Blood Vessel
- Bone
- Bone Marrow
- Brain
- Breast
- Colon
- Digestive
- Embryo
- Eye
- Hair
- Hair Follicle
- Heart
- Intestinal
- Kidney
- Liver
- Lung
- Mammary
- Mesentery
- Oral
- Ovary
- Pancreas
- Pituitary Gland
- Prostate
- Renal
- Reproductive
- Skeletal
- Skeletal Muscle
- Skin
- Spleen
- Stomach
- Straitum
- Testis
- Thyroid
- Primary Cells
- By Cell Type
- Adipocytes
- Astrocyte
- Cardiomyocyte
- Chondrocyte
- Dendritic
- Dermal Papilla Cells
- Endothelial
- Epithelial
- Fibroblast
- Interstitial
- Keratinocytes
- Keratocyte
- Kupffer
- Lymphocyte
- Macrophage
- Melanocyte
- Microglia
- Monocyte
- Mononuclear
- Neuron
- Osteoblast
- Preadipocytes
- Schwann Cells
- Skeletal Muscle
- Stellate
- Synoviocyte
- Trabecular Meshwork Cells
- Vascular Smooth Muscle Cells
- By Species Type
- By Tissue Type
- Adipose
- Airway
- Airway/Lung
- Auditory
- Blood
- Blood Vessel
- Bone
- Bone Marrow
- Brain
- Breast
- Cardiac
- Colon
- Digestive
- Eye
- Fat
- Gastrointestinal
- Hair
- Hair Follicle
- Heart
- Joint
- Kidney
- Liver
- Mammary
- Microvascular
- Muscle
- Nervous
- Oral
- Peritoneum
- Placenta
- Renal
- Reproductive
- Skeletal Muscal
- Skin
- Spleen
- Thyroid
- Umbilical
- Urogenital
- By Cell Type
- Stable Cell Lines
- Apoptosis Assay Cell Lines
- CRE Expression Cell Lines
- CRE Reporter Cell Lines
- CRISPR Ready Cell Lines
- Fluorescent Cell Lines
- GPCRs Expressing Cell Lines
- GPCRs Internalization Assay Cell Lines
- Immortalized Primary Cells
- Inducible Expression Cell Lines
- Ion Channel Cell Lines
- LacZ Cell Lines
- Luciferase Cell Lines
- Multiplexing GPCR Screening Cell Lines - NOMAD
- Neurodegenerative Disease Model Cell Line for Screening
- Other Stable Cell Lines
- Pathway Cell Lines
- Premade Labeled Cancer Cell Lines
- rtTA Cell Lines
- Stable Cell Lines for CNS Research
- Stable Cell Lines for Drug Screening in CNS
- TetR Cell Lines
- Transfected Stable Cell Lines
- Stem Cells
- Tumor Cells
- By Tissue Type
- Adrenal Gland
- Airway/Lung
- Ampulla of Vater
- Bile Duct
- Biliary Tract
- Bladder/Urinary Tract
- Blood
- Bone
- Bone Marrow
- Bowel
- Brain
- Breast
- Cervix
- CNS/Brain
- Colon
- Digestive
- Esophagus/Stomach
- Eye
- Head and Neck
- Kidney
- Larynx
- Liver
- Lung
- Lymphoid
- Mammary
- Myeloid
- Oral
- Other
- Ovary/Fallopian Tube
- Pancreas
- Peripheral Nervous System
- Pleura
- Prostate
- Renal
- Reproductive
- Skeletal
- Skin
- Soft Tissue
- Spleen
- Stomach
- Testis
- Thymic
- Thymus
- Thyroid
- Uterus
- Vulva/Vagina
- By Tissue Type
- Services
- Company
